Zadania maturalne z Biologii

Tematyka: replikacja, transkrypcja, translacja i splicing, ekspresja genów, prawa Mendla, prawa Morgana, choroby genetyczne i dziedziczność, zmienność genetyczna i mutacje – poziom rozszerzony.

Zadania pochodzą z oficjalnych arkuszy maturalnych CKE, które służyły przeprowadzaniu majowych egzaminów. Czteroznakowy kod zapisany przy każdym zadaniu wskazuje na jego pochodzenie: S/N – „stara”/”nowa” formuła; P/R – poziom podstawowy/rozszerzony; np. 08 – rok 2008.

Wkrótce przy każdym zadaniu pojawią się wzory odpowiedzi 🙂

.

Zadanie 101. (SR11)
Zaznacz zdania, które poprawnie opisują proces replikacji cząsteczki DNA.
A. Podczas replikacji DNA dwuniciowa helisa rozplata się i każda pojedyncza nić służy jako matryca do syntezy komplementarnej nici potomnej.
B. Syntezę nowych nici DNA przeprowadza enzym polimeraza DNA, którego cząsteczki są wbudowywane w powstającą nić DNA.
C. Kierunek syntezy obydwu potomnych nici DNA (nici prowadzącej i nici opóźnionej) jest zgodny z kierunkiem przesuwania się widełek replikacyjnych i synteza odbywa się w sposób ciągły.
D. Replikacja DNA ma charakter semikonserwatywny, ponieważ w skład każdej potomnej cząsteczki DNA wchodzi jedna oryginalna nić macierzysta i jedna nowo zsyntetyzowana.

Zadanie 102. (SR11)
Rodzice mają dwójkę potomstwa i spodziewają się kolejnego dziecka. Badania wykazały, że matka ma grupę krwi B, ojciec – grupę krwi A, starsze dziecko również grupę krwi A, a młodsze – ma grupę krwi 0.
a) Zapisz genotypy obojga rodziców, stosując dla oznaczenia alleli grup krwi symbole IA, IB, i.
b) Zapisz krzyżówkę ilustrującą dziedziczenie grup krwi w tej rodzinie i określ, jakie jest prawdopodobieństwo, że kolejne dziecko będzie miało grupę krwi B.

Zadanie 103. (SR11)
Terapię genową można stosować jako metodę leczenia chorych na nowotwory. W zwalczaniu czerniaka próbuje się wykorzystać następującą metodę: przygotowuje się genetycznie zmienione komórki nowotworu pacjenta, a następnie wprowadza się je do jego organizmu.
a) Wyjaśnij, dlaczego opisaną metodę można nazwać „szczepionką przeciwnowotworową”.
b) Określ, czy taka „szczepionka przeciwnowotworowa” przygotowana dla konkretnego pacjenta będzie skuteczna w terapii innego pacjenta. Odpowiedź uzasadnij.

Zadanie 104. (SR11)
Na schemacie przedstawiono proces zróżnicowanego składania genów.


a) Na podstawie schematu wyjaśnij, w jaki sposób z informacji genetycznej jednego genu mogą powstać różne białka.
b) Wyjaśnij, na czym polega obróbka potranskrypcyjna.

Zadanie 105. (SR11)
Poniższe opisy dotyczą różnych rodzajów zmienności. A. Prowadzi do powstania nowych alleli genów, które nie występowały w układzie rodzicielskim, a także może prowadzić do powstania zmian w strukturze lub ilości chromosomów. B. Warunki zewnętrzne (temperatura, światło, czy rodzaj pokarmu) mogą modyfikować efekty genów, przez co mogą wpływać decydująco na właściwości fenotypowe organizmu. C. W wyniku segregacji chromosomów w mejozie lub losowego łączenia się gamet powstają nowe kombinacje genów, co warunkuje różnorodność fenotypową potomstwa.
a) Obok poniższych nazw rodzajów zmienności wpisz litery (A, B, C), którymi oznaczono ich opisy.
 1 .fluktuacyjna …………… 2. rekombinacyjna …………… 3. mutacyjna ……………

b) Podaj, która z wymienionych zmienności nie ma znaczenia ewolucyjnego.

 

Zadanie 106. (SR11)
Jedną z podstawowych metod stosowanych obecnie w badaniach molekularnych i inżynierii genetycznej jest PCR (łańcuchowa reakcja polimerazy). Jest to reakcja umożliwiająca powielenie (amplifikację) w krótkim czasie fragmentu genomowego DNA w miliardach kopii. Metoda ta pozwala na analizę bardzo małych, wręcz śladowych ilości DNA.
Podaj dwa przykłady praktycznego zastosowania PCR.

Zadanie 107. (SR12)
Na schemacie przedstawiono proces translacji.

Na podstawie analizy schematu i własnej wiedzy wykonaj poniższe polecenia.
a) Oceń prawdziwość zdań dotyczących procesu translacji. Wpisz w odpowiednich miejscach tabeli literę P, jeśli zdanie jest prawdziwe, lub literę F, jeśli zdanie jest fałszywe.


b) Podaj zestawienie nukleotydów w antykodonie tRNA przenoszącym tyrozynę (Tyr).
c) Podaj znaczenie obecności porów w otoczce jądrowej dla procesu translacji.

 

Zadanie 108. (SR12)
Większość genów eukariotycznych jest podzielona na eksony i introny.
Napisz, czy mutacja w obrębie intronu określonego genu, która nie wpływa na sposób jego wycinania, może prowadzić do zmiany właściwości białka kodowanego przez ten gen. Odpowiedź uzasadnij.

 

Zadanie 109. (SR12)
Stwierdzono, że pewien organizm jest heterozygotą Aa względem jednej z cech, a drugą cechę warunkowaną przez allel B posiada w formie dominującej. Nie wiadomo jednak, czy pod względem tej cechy jest homozygotą, czy heterozygotą. Obie cechy dziedziczą się jednogenowo i niezależnie.
a) Zapisz wszystkie możliwe genotypy opisanego organizmu.
b) Zaznacz takie zestawienie genotypów obojga rodziców, których całe potomstwo będzie miało cechy organizmu opisanego w tekście. Uzasadnij odpowiedź, rozwiązując odpowiednią krzyżówkę genetyczną
A. aaBb, aaBb
B. aaBb, AaBB
C. aabb, AAbb
D. aaBb, AABB

Zadanie 110. (SR12)
Poniżej przedstawiono fragment rodowodu, obrazujący pojawianie się u ludzi pewnej choroby, determinowanej przez allel recesywny.
Na podstawie analizy schematu określ, czy allel warunkujący tę chorobę jest sprzężony z płcią. Odpowiedź uzasadnij.

Zadanie 111. (SR12)
Myszy o genotypie By B mają sierść żółtą, a myszy o genotypie BB – sierść czarną. Allel By wpływa jednocześnie na przeżywalność zarodków i w układzie homozygotycznym By By jest letalny (myszy o tym genotypie giną przed urodzeniem). Uznaje się, że zależnie od cechy fenotypowej, na którą wpływa, allel By może wykazywać właściwości dominujące lub recesywne w stosunku do allelu B.
Na podstawie: P.C. Winter, G.I. Hickey, H.L. Fletcher, Krótkie wykłady. Genetyka, PWN, Warszawa 2006.

a) Podaj stosunek liczbowy żywych myszy żółtych i czarnych w potomstwie krzyżówki myszy żółtych.
b) Określ, ze względu na którą cechę allel By jest recesywny. Odpowiedź uzasadnij.

Zadanie 112. (SR13)
Na wykresie przedstawiono uprawy GMO na świecie w latach 1996-2006


Na podstawie wykresu określ tendencję zmian powierzchni upraw GMO na świecie i podaj prawdopodobną jej przyczynę

 


Zadanie 113. (SR13)
W wielu hodowlach do celów gospodarczych i laboratoryjnych stosuje się krzyżowanie zwierząt blisko ze sobą spokrewnionych, czyli tzw. chów wsobny. O ile przynosi ono korzyści hodowcom, o tyle w warunkach naturalnych jest to zjawisko niekorzystne dla zwierząt.
a) Przedstaw zaletę kojarzenia krewniaczego w hodowli zwierząt.
b) Uzasadnij, że w warunkach naturalnych krzyżowanie się osobników blisko spokrewnionych jest zjawiskiem niekorzystnym wśród zwierząt.

Zadanie 114. (SR13)
U zwierząt obojnaczych (hermafrodytycznych), np. dżdżownicy lub ślimaka winniczka, podczas rozmnażania płciowego dwa osobniki łączą się ze sobą, żeby przekazać sobie wzajemnie nasienie.
Podaj nazwę opisanego procesu i wyjaśnij, dlaczego wymiana gamet pomiędzy osobnikami obojnaczymi jest korzystna.

Zadanie 115. (SR13)
Na rysunku przedstawiono (w sposób uproszczony) strzępki dwóch odmiennych płciowo, haploidalnych grzybni pieczarki biorących udział w procesie płciowym (somatogamii).


Zaznacz rysunek przedstawiający grzybnię, z której są zbudowane owocniki tej pieczarki.

 

Zadanie 116. (SR13)
Przeczytaj uważnie poniższą informację. „Wi-fi z laptopa zmienia kod genetyczny plemników”. Do takich wniosków doszli badacze, którzy zaobserwowali wpływ promieniowania elektromagnetycznego z laptopa na męską spermę – donosi „Daily Telegraph”.
Źródło: www.polskieradio.pl/23/3/Artykul/490491.

Wyjaśnij, dlaczego podkreślone sformułowanie zostało błędnie użyte.

Zadanie 117. (SR13)
Efekt dziedziczenia zmutowanego allelu powodującego defekt organizmu zależy od tego, czy allel ten jest dominujący, czy – recesywny. Na schematach przedstawiono dwa modele dziedziczenia (I i II) autosomalnej cechy jednogenowej. W obu rodowodach w pokoleniu F1 nie zaznaczono osób chorych.

a) Uzupełnij tabelę, wpisując oznaczenia cyfrowe zdrowych osób z pokolenia F1.


b) Określ prawdopodobieństwo (w %) wystąpienia choroby u kolejnego dziecka w pokoleniu F1, w obu zilustrowanych przypadkach.

 

Zadanie 118. (SR13)
Dystrofia mięśniowa typu Duchenne’a jest chorobą genetyczną uwarunkowaną allelem recesywnym, sprzężonym z płcią. Na schemacie przedstawiono rodowód ilustrujący dziedziczenie dystrofii mięśniowej w pewnej rodzinie.


a) Wymień numery wszystkich osób, które na pewno są nosicielami dystrofii mięśniowej Duchenne’a
b) Uzasadnij, dlaczego rodzice oznaczeni numerami 6 i 7 mogą mieć pewność, że ich córka nie będzie chora na dystrofię mięśniową.

Zadanie 119. (SR13)
Barwa tłuszczu u królików zależy od jednej pary alleli oraz od rodzaju pokarmu. Osobniki heterozygotyczne oraz homozygoty dominujące mają enzym rozkładający ksantofil (barwnik będący przyczyną żółtego zabarwienia tłuszczu). U homozygot recesywnych ten enzym jest nieaktywny, ale karmienie paszą pozbawioną ksantofilu powoduje, że ich tłuszcz jest biały. Skrzyżowano parę królików heterozygotycznych pod względem genu warunkującego barwę tłuszczu i otrzymano potomstwo o różnym zabarwieniu tłuszczu.
Określ procentowy udział fenotypów (barwa tłuszczu) wśród potomstwa tej pary królików w zależności od rodzaju otrzymywanej paszy. Procentowy udział fenotypów (tłuszcz biały i żółty) wśród potomstwa karmionego paszą
I. zawierającą ksantofil
II. bez ksantofilu

Zadanie 120. (SR14)
Wirusy grypy należą do RNA wirusów. Wyróżnia się trzy typy wirusów grypy – typu A, typu B lub typu C. Duża zmienność tych wirusów i powstawanie nowych szczepów utrudniają ich klasyfikację. W wirusach grypy typu A łatwo dochodzi do wymiany genów, określanej jako skok antygenowy. Ponadto występujące wśród RNA wirusów częste mutacje są przyczyną występowania epidemii grypy. Profilaktyka zakażeń wirusem grypy polega na stosowaniu szczepionek, jednak każdego roku trzeba przyjmować nową szczepionkę.
a) Uwzględniając mechanizm działania szczepionki, uzasadnij, dlaczego konieczne jest coroczne powtarzanie szczepienia przeciw grypie.
b) Wyjaśnij, dlaczego duża zmienność genetyczna wirusów grypy przyczynia się do występowania epidemii tej choroby.

 

Zadanie 121. (SR14)
Na rysunku przedstawiono proces ekspresji informacji genetycznej w komórce prokariotycznej.


a) Podaj nazwę rodzaju RNA oznaczonego na rysunku literą X.
b) Uzasadnij, podając jeden argument, że na rysunku przedstawiono proces ekspresji informacji genetycznej u organizmów prokariotycznych.

Zadanie 122. (SR14)
Na schemacie przedstawiono budowę cząsteczki tRNA uczestniczącej w procesie translacji, a w tabeli – fragment kodu genetycznego.

Zapisz triplet nukleotydów w kodonie mRNA oznaczony jako XYZ oraz nazwę aminokwasu, który zostanie przyłączony do przedstawionej cząsteczki tRNA.

 

Zadanie 123. (SR14)
Barwa kolców malin jest warunkowana przez dwa geny dziedziczące się niezależnie. Dominujący allel A jednego genu warunkuje pojawienie się kolców o zabarwieniu różowym, natomiast recesywny allel a tego genu odpowiada za ich kolor zielony. Obecność dominującego allelu B drugiego genu skutkuje zwiększeniem intensywności koloru różowego, co prowadzi do powstania kolców purpurowych. Allel B nie wpływa na zmianę barwy kolców zielonych. Po skrzyżowaniu rośliny o kolcach różowych z rośliną mającą kolce zielone otrzymano w pokoleniu F1 wszystkie rośliny o kolcach purpurowych.
a) Podaj genotypy roślin z pokolenia rodzicielskiego (P) mających:
różowe kolce …………………………………, zielone kolce ………………………………………….. .
b) Zaznacz zestaw fenotypów (A–D), które powinny wystąpić najliczniej i najmniej licznie wśród dużej liczby potomstwa uzyskanego z nasion po skrzyżowaniu roślin z pokolenia F1.

Zadanie 124. (SR14)
U kotów jedna para alleli (B i b) warunkująca barwę sierści jest sprzężona z płcią. Ruda barwa sierści jest warunkowana przez allel B (XB ), natomiast barwa czarna – przez allel b (Xb ). Osobniki heterozygotyczne mają barwę szylkretową (część włosów jest czarnych, część – rudych).
a) Ustal, jaką barwę sierści miał samiec, jeżeli wśród jego potomstwa z rudą samicą jedno kocię było szylkretowe, a troje kociąt było rudych. Zapisz genotyp i fenotyp tego samca.
b) Podaj płeć rudych kociąt w tym miocie.
c) Wyjaśnij, dlaczego wśród potomstwa tych kotów nie pojawią się szylkretowe samce

Zadanie 125. (SR14)

Badano częstość rekombinacji (% crossing-over) pomiędzy czterema genami: m, v, w oraz y, znajdującymi się na chromosomie X muszki owocowej.
Uzyskano następujące wyniki:
między m i v = 3,0 %
między m i y = 33,7 %
między v i w = 29,4 %
między w i y = 1,3 %
Na podstawie przedstawionych danych określ:
a) które dwa geny leżą na chromosomie najbliżej siebie
b) kolejność czterech badanych genów na chromosomie

Zadanie 126. (SR14)
Jedną z podstawowych metod stosowanych w badaniach molekularnych i inżynierii genetycznej jest łańcuchowa reakcja polimerazy, czyli PCR. Reakcja ta umożliwia powielenie (amplifikację) w miliardach kopii fragmentu genomowego DNA w czasie krótszym niż kilka godzin. Pojedyncza cząsteczka DNA może zostać amplifikowana do ilości, które ułatwiają jej analizę, charakteryzację i dalszą manipulację genetyczną. PCR wykorzystuje się m.in. do analizy markerów, pozwalających stwierdzić podwyższone ryzyko nowotworów.
Zaznacz dwie sytuacje, w których również wykorzystuje się reakcję PCR.
A. W testach wykrywających obecność wirusów (np. wirusa HIV) i niektórych bakterii.
B. Do wprowadzania do komórek roślinnych plazmidów z genami innych organizmów.
C. W diagnostyce chorób genetycznych, np. mukowiscydozy, choroby Huntingtona.
D. Do klonowania komórek w celach terapeutycznych, np. do leczenia chorób krwi.
E. Do identyfikacji płci płodu w diagnostyce prenatalnej.

Zadanie 127. (SR14)
Przeprowadzono test, który miał określić wpływ danego antybiotyku na pewien szczep bakterii. Uproszczony opis testu i jego wyników przedstawiono poniżej. Z jednej komórki bakteryjnej wyhodowano kolonię bakterii oznaczoną na rysunku cyfrą 1. Z pojedynczych komórek bakterii pobranych z kolonii 1. wyhodowano trzy kolonie oznaczone cyfrą 2. Z pojedynczych bakterii pochodzących z kolonii 2. uzyskano dziewięć kolonii oznaczonych na rysunku cyfrą 3. Następnie bakterie każdej z tych kolonii poddano działaniu tego samego antybiotyku i w takim samym stężeniu. Bakterie wszystkich kolonii zginęły – z wyjątkiem kolonii 3H.


Określ prawdopodobną przyczynę uzyskania przedstawionych wyników. W odpowiedzi uwzględnij podłoże genetyczne tego zjawiska.

Zadanie 128. (SR15)
Poniżej wymieniono procesy (A–D) dotyczące kwasów nukleinowych i zachodzące u organizmów eukariotycznych.
Wybierz właściwe nazwy procesów spośród A–D i przyporządkuj je do nazw produktów         1. i 2., które powstają w wyniku przebiegu tych procesów. Zapisz ich oznaczenia literowe.
A. replikacja B. translacja C. transkrypcja D. odwrotna transkrypcja
1.DNA
2. RNA

Zadanie 129. (SR15)
Na schemacie przedstawiono strukturę fragmentu genu β-globiny.


Na podstawie: M. Berg, J.L. Tymoczko, L. Stryer, Biochemia, Warszawa 2009.
a) Określ wielkość produktu transkrypcji przedstawionego fragmentu genu β-globiny, wyrażając ją liczbą zasad azotowych.
b) Podaj cechę przedstawionego genu, która umożliwia rozpoznanie, że jest to gen występujący w DNA jądrowym komórek eukariotycznych.

Zadanie 130. (SR15)
Na chromosomie 22 położony jest gen akrozyny – białka, które umożliwia plemnikowi przeniknięcie do komórki jajowej i jej zapłodnienie. Mutacja w tym genie powoduje męską niepłodność. Na tym samym chromosomie zlokalizowany jest także gen TP53, którego mutacja jest przyczyną genetycznie uwarunkowanego zespołu predyspozycji do nowotworów. Oceń, czy informacje dotyczące mechanizmu dziedziczenia genu akrozyny są prawdziwe.
Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

 

Zadanie 131. (SR15)
U pewnego gatunku owada, dominujący allel genu (B) zlokalizowany na chromosomie płci X koduje białko niezbędne w procesie kariokinezy. Allel recesywny tego genu (b) w stanie homozygotycznym wywołuje efekt letalny. Samice tych owadów mają parę chromosomów płci XX, a samce – XY. Określ prawdopodobieństwo urodzenia się żywego potomstwa heterozygotycznej samicy i zdrowego samca.
Uzasadnij odpowiedź − zapisz krzyżówkę genetyczną.

Zadanie 132. (SR15)
Na rysunku przedstawiono kariotyp prawidłowej gamety pewnego owada, a poniżej – kariotypy dwóch zmutowanych gamet: 1. i 2.


a) Opisz różnicę między gametami zmutowanymi (1. i 2.) a gametą prawidłową.
b) Podaj przyczynę mutacji, która doprowadziła do powstania gamet 1. i 2.

Zadanie 133. (SR15)
Skrzyżowano dwie karłowate rośliny pewnego gatunku: jedna z nich miała kwiaty czerwone, a druga – kwiaty białe. W pokoleniu potomnym wszystkie rośliny miały kwiaty różowe. Wśród nich 75% stanowiły rośliny karłowate, a 25% – rośliny wysokie. Uwaga: poniższe informacje wykorzystaj do rozwiązania polecenia 27b). Między allelami genu mogą występować podane niżej formy dominacji (I–III):
I. Dominacja całkowita – u heterozygot cechy warunkowane przez allel dominujący ujawniają się w pełni.
II. Dominacja niecałkowita – u heterozygot cechy warunkowane przez allel dominujący ujawniają się tylko częściowo.
III. Kodominacja (współdominowanie) – u heterozygot ujawniają się cechy warunkowane przez obydwa allele. a) Uzupełnij poniższą legendę – wpisz obok literowych oznaczeń alleli warunkowane przez nie warianty cech.
Następnie, na podstawie tej legendy, zapisz genotypy form rodzicielskich. Zastosuj litery:
A i a – na określenie alleli warunkujących wysokość roślin
B i b – na określenie alleli barwy kwiatów
b) Określ, które z wymienionych powyżej form dominacji (I–III) występują między
1. allelami warunkującymi wysokość roślin przedstawionego gatunku
2. allelami warunkującymi barwę kwiatów tych roślin

Zadanie 134. (SR15)
Analizowano sposób dziedziczenia trzech cech u pewnej rośliny. Każda cecha warunkowana jest jednym genem. Wykonano odpowiednie dwugenowe krzyżówki, a ich wyniki zamieszczono w tabeli.


Na podstawie analizy wyników z tabeli podaj, która para genów jest sprzężona. Odpowiedź uzasadnij.

Zadanie 135. (SR16)
Na schemacie przedstawiono zarówno cykl komórkowy, w którym wyróżnia się podział jądra komórkowego – mitozę (M) wraz z towarzyszącą mu cytokinezą, jak i czas między podziałami komórki – interfazę, na którą składają się fazy: G1, S, G2. Po zakończeniu podziału większość komórek organizmu człowieka wchodzi w fazę G0. Komórki takie nie ulegają dalszym podziałom, a po różnicowaniu pełnią określone funkcje w tkankach i narządach. Jednak niewielki, stały odsetek komórek znajdujących się w fazie G0 zachowuje zdolność do podziału.
Na podstawie: Fizjologia człowieka z elementami fizjologii stosowanej i klinicznej, pod red. W.Z. Traczyka, A. Trzebskiego, Warszawa 2001.


a) Określ, jakie znaczenie dla narządów organizmu człowieka ma fakt, że komórki fazy G0 mogą wrócić do cyklu komórkowego.
b) Podaj, w której fazie cyklu komórkowego zachodzi replikacja DNA.

Zadanie 136. (SR16)
Do połowy lat 60-tych XX wieku przebieg ekspresji informacji genetycznej u wszystkich organizmów wg schematu: DNA → RNA → polipeptyd (białko), uznawano w biologii za dogmat. Kiedy odkryto RNA-wirusy (np. retrowirusy, takie jak wirus HIV), okazało się, że ekspresja informacji genetycznej może mieć inny przebieg.


Uzupełnij zapis przebiegu ekspresji informacji genetycznej u retrowirusów – podaj nazwy poszczególnych etapów, które należy wpisać nad strzałkami 1–4

 


Zadanie 137. (SR16)
Na rysunku przedstawiono model replikacji DNA u eukariontów.

Na podstawie: J. Kączkowski, Biochemia roślin, Warszawa 1992.
Na podstawie informacji z rysunku oraz własnej wiedzy wybierz spośród A–E i zaznacz dwa zdania, które prawidłowo opisują przedstawiony proces replikacji.
A. Replikacja na obu niciach jest możliwa dzięki istnieniu fragmentów Okazaki.
B. Helikazy to enzymy uczestniczące w rozplataniu podwójnej helisy.
C. Kierunek syntezy obu nowych nici (wiodącej i opóźnionej) jest od końca 5’ do końca 3’.
D. Do inicjacji replikacji każdej nici wystarczy jeden starter RNA.
E. Proces replikacji odbywa się samorzutnie bez nakładu energii.

Zadanie 138. (SR16)
Podkreśl w przedstawionym tekście zdanie zawierające błędną informację i zapisz jej prawidłową formę w miejscu wyznaczonym poniżej.
„Naukowcy i lekarze ostrzegają przed szerokim stosowaniem antybiotyków, ponieważ może to prowadzić do powstania szczepów bakterii opornych na te antybiotyki. W pojedynczej komórce bakteryjnej oporność na antybiotyk może powstać na drodze mutacji w jej kodzie genetycznym. Plazmidy zawierające zmutowane geny mogą być przekazywane innym bakteriom, które w ten sposób także uzyskują oporność na antybiotyk”.

Zadanie 139. (SR16)
Informację genetyczną komórki chroni przed uszkodzeniem białko p53, nazywane „strażnikiem genomu”. Zdrowe komórki zawierają utajoną (nieaktywną) formę p53 o stężeniu utrzymywanym na niskim poziomie. Pod wpływem czynników uszkadzających DNA (promieniowanie γ, UV, niedotlenienie) dochodzi do aktywacji i wzrostu ilości białka p53. Aktywacja p53 powoduje zatrzymanie cyklu komórkowego w celu naprawy uszkodzeń. Jeśli uszkodzenia są zbyt rozległe i ich naprawa jest niemożliwa, p53 indukuje wtedy zaprogramowaną śmierć komórki (apoptozę). Ponad połowa ludzkich nowotworów charakteryzuje się mutacją w genie kodującym białko p53.
Na podstawie: http://bioinfo.mol.uj.edu.pl/articles/Slezak05
Na podstawie tekstu wyjaśnij, dlaczego mutacja genu białka p53 ułatwia rozwój nowotworów.

Zadanie 140. (SR16)
Kury andaluzyjskie mogą mieć upierzenie białe, czarne lub stalowoniebieskie (szare). Potomstwo białego koguta i czarnej kury oraz czarnego koguta i białej kury jest wyłącznie stalowoniebieskie, natomiast wśród potomstwa rodziców stalowoniebieskich występują osobniki białe, stalowoniebieskie i czarne w stosunku: 1 : 2 : 1.
a) Zaznacz poprawne dokończenie zdania określającego sposób dziedziczenia opisanej barwy upierzenia kur andaluzyjskich. Taki rozkład fenotypów wśród potomstwa świadczy o
A. kodominacji alleli genu warunkującego barwę piór.
B. warunkowaniu barwy upierzenia przez dwie pary alleli.
C. występowaniu trzech alleli genu warunkującego barwę piór.
D. niezupełnej dominacji alleli genu warunkującego barwę piór.

b) Określ, jakie fenotypy i w jakim stosunku wystąpią wśród potomstwa stalowoniebieskiej kury i białego koguta.

Zadanie 141. (SR16)
Achondroplazja jest chorobą genetyczną autosomalną, której rezultatem jest m.in. karłowatość. Rodzice chorzy na achondroplazję mają dwoje dzieci: jedno jest chore na tę chorobę, a drugie – zdrowe.
a) Na podstawie tekstu określ, jaki allel – dominujący czy recesywny – jest odpowiedzialny za wystąpienie achondroplazji. Odpowiedź uzasadnij, odwołując się do tekstu.
b) Zapisz genotypy obojga rodziców opisanych w tekście. Do oznaczenia alleli zastosuj symbole literowe: (A) i (a).

Zadanie 142. (SR16)
Dryf genetyczny to zmiany w częstości występowania alleli w populacji, które nie wynikają z działania doboru naturalnego, ale są skutkiem zdarzeń losowych. Oceń, czy poniższe informacje dotyczące skutków dryfu genetycznego są prawdziwe.
Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

Zadanie 143. (SR16)
Na podział komórki składają się dwa etapy: podział jądra, czyli kariokineza, i podział cytoplazmy – cytokineza. Istnieją trzy typy podziału jądra komórkowego: amitoza, mitoza i mejoza. Na rysunku przedstawiono jedną z faz kariokinezy zachodzącą w komórce, która ma cztery chromosomy.
a) Zaznacz poniżej (A–D) nazwę fazy kariokinezy, którą przedstawiono na rysunku.
A. metafaza I mejozy
B. metafaza mitozy
C. anafaza I mejozy
D. anafaza mitozy
b) Określ liczbę chromosomów, jaką będą miały komórki potomne po zakończonym podziale, którego fazę przedstawiono na rysunku.

Zadanie 144. (SR17)
Pod wpływem ogrzewania struktura podwójnej helisy DNA ulega zniszczeniu i rozpada się na pojedyncze nici. Temperatura, w której dochodzi do utraty połowy helikalnej struktury tej cząsteczki, nazywana jest temperaturą denaturacji cząsteczki DNA. Wartość tej temperatury jest zależna od składu nukleotydów budujących cząsteczkę DNA. Denaturacja jest procesem odwracalnym (renaturacja).
a) Zaznacz poprawne dokończenie zdania. Wartość temperatury denaturacji będzie najwyższa w przypadku fragmentu cząsteczki DNA, którego jedna z nici (1.– 4.) zawiera następującą sekwencję zasad:
1. TGA GAT CAT GAT
2. CCC GGA GAT TTA
3. AAT CGA TTC GTA
4. TAC CCT ATC GAT
b) Wyjaśnij, dlaczego wartość temperatury denaturacji cząsteczki DNA jest zależna od jej składu nukleotydowego.

Zadanie 145. (SR17)
Wśród zasad azotowych wchodzących w skład fragmentu nici DNA kodującej (nieulegającej transkrypcji), tymina stanowi 35%, guanina – 15%, a cytozyna – 20%.
Podaj udział procentowy wszystkich zasad azotowych wchodzących w skład:
1. nici matrycowej tego fragmentu DNA
2. pre-mRNA powstałego w wyniku transkrypcji tego fragmentu DNA.

 


Zadanie 146. (SR17)

U bydła brak rogów dominuje zupełnie nad ich występowaniem. Bezrożnego buhaja skrzyżowano z trzema krowami. Potomstwo urodzone przez:
A. rogatą krowę nr 1. – było rogate,
B. bezrożną krowę nr 2. – było rogate,
C. bezrożną krowę nr 3. – było bezrożne.

a) Podaj genotyp buhaja i wszystkie możliwe genotypy krów: 1., 2. i 3., przy czym allel warunkujący bezrożność oznacz literą B.
b) Zapisz krzyżówkę genetyczną (szachownicę Punnetta) i na jej podstawie określ stosunek liczbowy genotypów i fenotypów potomstwa bezrożnego buhaja i krowy nr 2.

 

Zadanie 147. (SR17)
Dystrofia mięśniowa Duchenne’a jest nieuleczalną chorobą genetyczną objawiającą się nieodwracalnym zanikiem mięśni. Pierwsze objawy występują w wieku 3 do 8 lat, a w wieku 12 lat większość chorych nie jest już w stanie samodzielnie chodzić. Średni okres przeżycia wynosi w USA 28 lat, a śmierć następuje najczęściej w wyniku niewydolności oddechowej lub niewydolności krążenia. Ze względu na sposób dziedziczenia tej choroby zapadają na nią niemal wyłącznie chłopcy z częstością 1 na 3500 urodzeń. Istnieją pojedyncze przypadki wystąpienia tej choroby u dziewczynek z zespołem Turnera (jeden chromosom X).
Wyjaśnij, dlaczego na tę chorobę zapadają prawie wyłącznie chłopcy. W odpowiedzi weź pod uwagę genotypy chorych chłopców oraz ich rodziców.

Zadanie 148. (SR17)
Uporządkuj etapy procesu prowadzącego do otrzymania transgenicznej kukurydzy wytwarzającej prowitaminę A. Wpisz w tabelę numery 2–6.

Zadanie 149. (SR18)
Pod koniec XX wieku zaczęto stosować badania DNA dla potrzeb sądownictwa. Gdy w próbce jest zbyt mało DNA jądrowego, lub gdy jest on mocno zniszczony, bierze się pod uwagę DNA mitochondrialny – mtDNA, który występuje w komórkach w większej liczbie kopii niż jądrowy. Zygota człowieka otrzymuje ok. 100 tys. cząsteczek mtDNA, które znajdowały się w mitochondriach oocytu. Mitochondria obecne w plemniku, zawierające po ok. 100 kopii mtDNA, po zapłodnieniu degenerują wraz z ich zawartością, w wyniku niepoznanego dotąd dobrze mechanizmu.
Na podstawie: K. Gawęda-Walerych, I.Sołtyszewski, Zastosowanie analizy mitochondrialnego DNA w badaniach kryminalistycznych, www.badanieojccostwa.pl

Na podstawie przedstawionych informacji wyjaśnij, dlaczego mtDNA, w przeciwieństwie do DNA jądrowego, nie może być wykorzystywany do ustalania ojcostwa.

Zadanie 150. (SR18)
Ekspresja genów to wieloetapowy proces prowadzący do ujawnienia informacji zawartej w genie, odczytywanej w procesie transkrypcji i wykorzystywanej do syntezy białka w procesie translacji. Na schemacie przedstawiono sposób regulacji ekspresji genów u bakterii na przykładzie operonu laktozowego.


Oceń, czy poniższe informacje dotyczące regulacji ekspresji genów operonu laktozowego u bakterii są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

Zadanie 151. (SR18)
Na rysunku przedstawiono parę chromosomów homologicznych i położenie czterech genów (I–IV).

Określ, w przypadku których par loci – I i II czy III i IV – występuje większe prawdopodobieństwo sprzężonego dziedziczenia alleli. Odpowiedź uzasadnij.

Zadanie 152. (SR18)
Daltonizm jest chorobą genetyczną uwarunkowaną allelem recesywnym sprzężonym z płcią. Na schemacie przedstawiono rodowód ilustrujący dziedziczenie daltonizmu w pewnej rodzinie.

a) Zapisz genotypy osób oznaczonych numerami 5 i 16. Allel warunkujący chorobę oznacz literą d.
b) Podaj przykład objawów tej choroby.

Zadanie 153. (SR18)
U kotów brytyjskich produkcja eumelaniny, czyli czarnego barwnika, jest modyfikowana przez trzy allele genu autosomalnego, które w zależności od układu, w jakim pojawiają się w genotypie kota, determinują kolor włosa: B – allel dominujący w stosunku do pozostałych, warunkujący barwę czarną, b – allel recesywny w stosunku do B, ale dominujący w stosunku do b1 , warunkujący barwę czekoladową, b1 – allel recesywny zarówno w stosunku do B, jak i do b, warunkujący barwę cynamonową. Ekspresja genu odpowiedzialnego za produkcję eumelaniny modyfikowana jest przez autosomalny gen z innego chromosomu, którego allel D warunkuje równomierne rozproszenie barwnika, co daje normalną barwę włosa, natomiast recesywny allel d sprawia, że pigment występuje w skupiskach, co skutkuje rozjaśnieniem (rozmyciem) kolorów: czarnego – do niebieskiego, czekoladowego – do liliowego, a cynamonowego – do płowego.
 Na podstawie: http://www.agiliscattus.pl/podstawy-genetyki-kotow.html
a) Zapisz, stosując podane oznaczenia alleli genów, genotypy kotów brytyjskich: cynamonowej samicy i czarnego samca, w których potomstwie znajdują się kocięta czarne, czekoladowe, niebieskie oraz liliowe.
b) Zapisz krzyżówkę genetyczną (szachownicę Punnetta) cynamonowej samicy i czarnego samca (rodziców z zadania 26a) i na podstawie tej krzyżówki określ prawdopodobieństwo, że kolejne kocię tych rodziców będzie niebieskie.

 

Zadanie 154. (NR15)
Rak wątroby jest chorobą, która może mieć wiele przyczyn. Jedną z nich jest wirusowe zapalenie wątroby typu B, wywołane przez wirus HBV. Wirus ten przenosi się podczas kontaktu z zakażoną krwią lub płynami ustrojowymi i namnaża się w komórkach wątroby. Według Światowej Organizacji Zdrowia (WHO) znacząca część ludzkości jest zainfekowana wirusem, ale u wielu ludzi zakażenie jest bezobjawowe i dochodzi do pełnego wyleczenia połączonego z nabyciem odporności. Ze względu na zmienność sekwencji DNA wirusa wyróżnia się kilka jego typów. WHO zaleca szczepienia przeciw HBV. W diagnostyce zakażeń wirusem HBV stosuje się kilka metod:
I. metodę serologiczną, w której wykrywa się we krwi antygeny powierzchniowe wirusa;
II. metodę serologiczną, w której wykrywa się we krwi przeciwciała przeciwko antygenom wirusa;
III. metodę, w której wykorzystuje się jedną z technik inżynierii genetycznej – technikę PCR.
I. Oceń, czy sformułowane przez uczniów hasła propagujące szczepienia przeciw HBV zawierają informacje prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.


II. Określ, za pomocą której metody diagnostycznej (I–III) można stwierdzić, że osoba zdrowa, która nie była szczepiona przeciw HBV, w przeszłości przeszła wirusowe zapalenie wątroby typu B. Odpowiedź uzasadnij.

 


III. Podaj, którą metodę (I–III) należy zastosować, aby można było z największą dokładnością określić typ wirusa HBV, który w badanej próbce krwi znajduje się w bardzo małej ilości. Odpowiedź uzasadnij.

Zadanie 155. (NR15)
Autosomalny allel (D), warunkujący obecność w erytrocytach czynnika Rh (Rh+ ), dominuje nad allelem (d) – brak czynnika Rh (Rh– ). W tabeli przedstawiono pary rodziców (A–D) o różnych grupach krwi pod względem czynnika Rh.
I. Podaj wszystkie możliwe pary genotypów rodzicielskich, przy których prawdopodobieństwo urodzenia dziecka mającego grupę krwi Rh+ wynosi 100%. Zastosuj odpowiednie oznaczenia alleli, które zostały podane w tekście.
II. N Spośród par rodziców A–D wybierz tę, w przypadku której może wystąpić choroba hemolityczna noworodka, wywołana tzw. konfliktem serologicznym. Odpowiedź uzasadnij, uwzględniając obecność Rh w erytrocytach dziecka i matki oraz możliwe genotypy ojca.

Zadanie 156. (NR15)
U groszku pachnącego (Lathyrus odoratus) autosomalne allele (A) i (B) dwóch różnych genów kodują dwa enzymy odpowiedzialne za wytworzenie różowego barwnika płatków kwiatów. Każdy z tych enzymów katalizuje jeden z dwóch etapów syntezy barwnika różowego i brak nawet jednego z nich powoduje białą barwę kwiatów. Skrzyżowano dwie biało kwitnące rośliny, w wyniku czego w pokoleniu pierwszym (F1) otrzymano wyłącznie rośliny mające kwiaty różowe o genotypie AaBb, gdzie recesywne allele tych genów (a) i (b) to zmutowane allele kodujące niefunkcjonalne enzymy. Każdy z dwóch genów odpowiedzialnych za wytworzenie różowego barwnika kwiatów występuje w populacji groszku w postaci dwóch alleli.
I. Podaj wszystkie możliwe genotypy roślin o kwiatach białych oraz podkreśl wśród nich dwa, których skrzyżowanie ze sobą doprowadzi do uzyskania wyłącznie roślin o kwiatach różowych.
II. Wykonaj krzyżówkę genetyczną (szachownicę Punnetta) i na jej podstawie określ fenotypy pokolenia drugiego (F2) powstałego po skrzyżowaniu roślin o genotypach AaBb. Podaj, w jakim stosunku liczbowym występują fenotypy w pokoleniu F2.
III. Oceń, czy poniższe informacje dotyczące dziedziczenia barwy kwiatów u groszku pachnącego są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

 

Zadanie 157. (NR15)
Cząsteczka insuliny składa się z dwóch różnych łańcuchów polipeptydowych – A i B. Występują w niej trzy mostki dwusiarczkowe stabilizujące strukturę cząsteczki: jeden w łańcuchu polipeptydowym A oraz dwa – łączące łańcuchy A i B. Początek sekwencji kodującej (znajdującej się na nici nieulegającej transkrypcji) genu kodującego jeden z łańcuchów polipeptydowych insuliny jest następujący:
5’ ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCG … 3’.
Podczas eksperymentu użyto czynnika mutagennego, który w dwu przypadkach wywołał delecje, tzn. transkrybowane mRNA było pozbawione fragmentu sekwencji składającego się z kolejnych nukleotydów. W wyniku translacji powstały łańcuchy polipeptydowe (1. i 2.) o innej sekwencji aminokwasów niż w łańcuchu prawidłowym.
I. przypadek – polipeptyd 1. powstał na podstawie delecji 4 nukleotydów (od 10 do 13 nukleotydu sekwencji kodującej włącznie)
II. przypadek – polipeptyd 2. powstał na podstawie delecji 9 nukleotydów (od 10 do 18 nukleotydu sekwencji kodującej włącznie).
I. Na podstawie tekstu uzasadnij, że cząsteczka insuliny ma strukturę III- i IV-rzędową.
II. Określ, który polipeptyd (1. czy 2.) będzie miał bardziej zmienioną sekwencję aminokwasów w porównaniu z polipeptydem prawidłowym. Odpowiedź uzasadnij.
III. Podaj nazwę czwartego aminokwasu w sekwencji prawidłowego polipeptydu oraz nazwę czwartego aminokwasu w polipeptydzie 1. Przyjmij założenie, że w ich skład nie wchodzi aminokwas kodowany przez kodon START.
IV. Określ, czy opisane mutacje mogły być spowodowane działaniem kolchicyny, która jest czynnikiem mutagennym blokującym wrzeciono kariokinetyczne. Odpowiedź uzasadnij. 

Zadanie 158. (NR16)
Przykładem organizmów modyfikowanych genetycznie (GMO) są transgeniczne bakterie Escherichia coli, wytwarzające ludzką insulinę. Do genomu tych bakterii wprowadzony został fragment DNA, tzw. cDNA (ang. complementary DNA), syntezowany na matrycy mRNA wyizolowanego z komórek trzustki, będącego matrycą do wytwarzania insuliny.
I. Wyjaśnij, dlaczego do genomu modyfikowanych bakterii nie wprowadza się odcinka DNA z genem ludzkiej insuliny, tylko cDNA wytworzone na podstawie mRNA transkrybowanego z tego genu.
II. Uzasadnij prawdziwość stwierdzenia: „Każdy organizm transgeniczny jest GMO, ale nie każdy GMO to organizm transgeniczny”.

Zadanie 159. (NR16)
W nici kodującej (nieulegającej transkrypcji) pewnego genu zaszła mutacja punktowa w sekwencji 5’ TGT 3’, polegająca na zmianie (substytucji) jednego nukleotydu. W tym fragmencie sekwencji zakodowany jest pojedynczy aminokwas


I. Uzupełnij schemat ilustrujący skutki różnych substytucji, do których mogło dojść w opisanej sekwencji. Wpisz w pola 1.–3. odpowiednie sekwencje DNA.
II. Wyjaśnij, w jaki sposób mutacja, na skutek której powstała cząsteczka białka różniąca się od cząsteczki prawidłowej obecnością tryptofanu zamiast cysteiny, może wpłynąć na zmianę struktury trzeciorzędowej tego białka. W odpowiedzi uwzględnij budowę obu aminokwasów.

 

Zadanie 160. (NR16)
Geny odpowiadające za kolor ciała i kształt skrzydeł muszki owocowej (Drosophila melanogaster) występują na chromosomie 2. Dominujący allel genu odpowiadającego za kolor ciała (B) determinuje szarą barwę, a recesywny allel (b) warunkuje ciemne zabarwienie. Kształt skrzydeł zależy od dwóch alleli innego genu: dominujący allel (G) warunkuje normalne, proste skrzydła, natomiast allel recesywny (g) – skrzydła wygięte. Skrzyżowano podwójnie homozygotyczną, ciemną samicę o wygiętych skrzydłach z podwójnie heterozygotycznym, szarym samcem o prostych skrzydłach. Otrzymano liczne potomstwo o czterech fenotypach w różnej liczebności: 435 osobników szarych o prostych skrzydłach, 441 osobników ciemnych o skrzydłach wygiętych, 158 osobników szarych o skrzydłach wygiętych, 166 osobników ciemnych o prostych skrzydłach.
I. Zapisz genotypy krzyżowanych osobników: wykorzystaj podane w tekście oznaczenia alleli obu genów.
II. Zaznacz poprawne dokończenie zdania. Zrekombinowane układy alleli w potomstwie muszek o opisanych genotypach powstały dzięki procesowi crossing-over, który zaszedł w
A. spermatocytach.
B. oocytach.
C. plemnikach.
D. komórkach jajowych.
IV. Oblicz odległość, w jakiej w chromosomie 2. leżą geny warunkujące kolor ciała i kształt skrzydeł muszki owocowej. Zapisz obliczenia.
V. Zapisz oczekiwany stosunek fenotypów, który wystąpiłby w potomstwie tej pary muszek w sytuacji, gdyby geny warunkujące kolor ciała i kształt skrzydeł znajdowały się w różnych chromosomach.
Stosunek fenotypów: szare o prostych skrzydłach : ciemne o wygiętych skrzydłach : szare o wygiętych skrzydłach : ciemne o prostych skrzydłach

Zadanie 161. (NR16)
Kury andaluzyjskie mogą mieć upierzenie białe, czarne lub stalowoniebieskie (szare). Potomstwo białego koguta i czarnej kury oraz czarnego koguta i białej kury jest wyłącznie stalowoniebieskie, natomiast wśród potomstwa rodziców stalowoniebieskich występują osobniki białe, stalowoniebieskie i czarne w stosunku: 1 : 2 : 1.
I. Zaznacz poprawne dokończenie zdania określającego sposób dziedziczenia opisanej barwy upierzenia kur andaluzyjskich. Taki rozkład fenotypów wśród potomstwa świadczy o
A. kodominacji alleli genu warunkującego barwę piór.
B. warunkowaniu barwy upierzenia przez dwie pary alleli.
C. występowaniu trzech alleli genu warunkującego barwę piór.
D. niezupełnej dominacji alleli genu warunkującego barwę piór.

II. Określ, jakie fenotypy i w jakim stosunku wystąpią wśród potomstwa stalowoniebieskiej kury i białego koguta.

Zadanie 162. (NR16)
Dryf genetyczny to zmiany w częstości występowania alleli w populacji, które nie wynikają z działania doboru naturalnego, ale są skutkiem zdarzeń losowych.
Oceń, czy poniższe informacje dotyczące skutków dryfu genetycznego są prawdziwe. Zaznacz P, jeśli informacja jest prawdziwa, albo F – jeśli jest fałszywa.

 

Zadanie 163. (NR17)
Wyjaśnij, dlaczego płodny mężczyzna mający chorobę genetyczną, która jest uwarunkowana mutacją w genie mitochondrialnym, nie przekaże allelu warunkującego tę chorobę swoim dzieciom.

Zadanie 164. (NR17)
U ptaków dziedziczenie płci jest odmienne niż u ssaków. Płeć męska jest homogametyczna (chromosomy płci samca oznacza się ZZ), natomiast samice są heterogametyczne (ZW). U kury domowej na chromosomie Z występuje gen, który odpowiada za rodzaj upierzenia – dominujący allel tego genu (B) powoduje okresowe hamowanie odkładania się czarnego pigmentu podczas wzrostu pióra, co skutkuje pojawianiem się jasnych oraz czarnych prążków na chorągiewce i daje upierzenie zwane jastrzębiatym (paskowanym), natomiast allel recesywny (b) warunkuje upierzenie jednolicie czarne. Skrzyżowano jastrzębiatego koguta z jednolicie czarną kurą i otrzymano potomstwo czarne i jastrzębiate.
Na podstawie: K. Charon, M. Świtoński, Genetyka i genomika zwierząt, Warszawa 2012.
I. Oceń, czy poniższe stwierdzenia dotyczące dziedziczenia opisanej cechy kury domowej są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.


II. Zapisz genotypy krzyżowanych osobników. Wykorzystaj oznaczenia literowe alleli i chromosomów podane w tekście.
III. Wykonaj odpowiednią krzyżówkę genetyczną (szachownicę Punnetta) i na jej podstawie określ możliwe fenotypy potomstwa, uwzględniające upierzenie i płeć. Dla każdego z fenotypów określ prawdopodobieństwo, że z kolejnego jaja wykluje się ptak o określonych cechach.

Zadanie 165. (NR18)
Chromosom Filadelfia to charakterystyczny chromosom, powstający w wyniku mutacji, na skutek której gen BCR, znajdujący się na chromosomie 22, został połączony z genem Abl, przeniesionym z chromosomu 9. Gen Abl koduje enzym kinazę tyrozynową, która jest odpowiedzialna za różnicowanie, podział komórki i jej odpowiedź na uszkodzenia. W prawidłowych warunkach ekspresja tego genu i produkcja kinazy tyrozynowej podlega w komórce ścisłej regulacji. Po połączeniu genu Abl z genem BCR powstaje gen BCR-Abl, ulegający ciągłej, niekontrolowanej ekspresji (staje się onkogenem) i wymykający się spod kontroli komórki, co skutkuje zwiększeniem tempa podziałów komórkowych, hamowaniem apoptozy i ograniczeniem możliwości naprawy DNA. Obecność chromosomu Filadelfia wykazano u 95 % chorych na przewlekłą białaczkę szpikową. Obecnie w leczeniu tej białaczki stosuje się lek, który blokuje działanie kinazy tyrozynowej. Jego podawanie prowadzi do zahamowania rozwoju nowotworu, nie doprowadza jednak do wyleczenia chorych. Na schemacie przedstawiono powstawanie chromosomu Filadelfia.


I. Zaznacz rodzaj mutacji, w wyniku której powstał chromosom Filadelfia.
A. inwersja
B. transwersja
C. transdukcja
D. translokacja
II. Na podstawie przedstawionych informacji oceń, czy poniższe stwierdzenia dotyczące opisanej mutacji są prawdziwe. Zaznacz P, jeśli stwierdzenie jest prawdziwe, albo F – jeśli jest fałszywe.


III. Określ, czy przedstawiony sposób leczenia białaczki szpikowej spowodowanej opisaną mutacją można uznać za terapię genową. Odpowiedź uzasadnij.
IV.
Uporządkuj etapy procesu prowadzącego do otrzymania transgenicznej kukurydzy wytwarzającej prowitaminę A. Wpisz w tabelę numery 2–6.

Zadanie 166. (NR18)
Białka histonowe, typowe dla eukariontów, zbudowane są z części globularnej oraz z tzw. ogonka, wystającego poza nukleosom. Ogonki białek histonowych są miejscem modyfikacji chemicznych polegających m.in. na acetylacji i deacetylacji. Modyfikacje te wpływają na strukturę chromatyny: regulują w ten sposób ekspresję informacji genetycznej w komórce. Na schemacie przedstawiono modyfikacje fragmentu chromatyny o długości ok. 600 par zasad.


I. Podaj, który z procesów przedstawionych na schemacie – acetylacja czy deacetylacja – prowadzi do zahamowania ekspresji informacji genetycznej danego fragmentu DNA. Odpowiedź uzasadnij, odwołując się do znaczenia powstałych zmian w strukturze chromatyny.
II. Określ, czy prawdziwe jest stwierdzenie, że procesy przedstawione na schemacie nie mogą zachodzić w mitochondrium. Odpowiedź uzasadnij.

Zadanie 167. (NR18)
Wśród mikroflory jelita krwiopijnego pluskwiaka Rhodnius prolixus, który jest wektorem świdrowca wywołującego u ludzi groźną chorobę Chagasa, dominuje bakteria – Rhodococcus rhodnii. Do genomu tej bakterii wprowadzono gen ćmy kodujący cekropinę A – peptyd wywołujący śmierć świdrowca. W wyniku tego w ciele pluskwiaka liczba świdrowców znacznie spadła. Preparaty zawierające transgeniczne bakterie Rhodococcus rhodnii mogą być wykorzystywane do zapobiegania roznoszenia choroby Chagasa poprzez wprowadzanie ich do środowiska życia pluskwiaków.
Na podstawie: M. Kukla, Z. Piotrowska-Seget, Symbioza owady – bakterie, „Kosmos”, t. 60/2011.
I. Wyjaśnij, dlaczego gen kodujący cekropinę A wprowadza się do genomu bakterii Rhodococcus rhodnii w postaci cDNA otrzymanego w wyniku odwrotnej transkrypcji na matrycy eukariotycznego mRNA.
II. Uzasadnij tezę, że stosowanie preparatów zawierających transgeniczne bakterie Rhodococcus rhodnii w celu zapobiegania roznoszenia choroby Chagasa jest korzystniejsze dla środowiska niż stosowanie chemicznych metod zwalczania tego pluskwiaka.

Zadanie 168. (NR18)
U kotów brytyjskich produkcja eumelaniny, czyli czarnego barwnika, jest modyfikowana przez trzy allele genu autosomalnego, które w zależności od układu, w jakim pojawiają się w genotypie kota, determinują kolor włosa:
B – allel dominujący w stosunku do pozostałych, warunkujący barwę czarną,
b – allel recesywny w stosunku do B, ale dominujący w stosunku do b1 , warunkujący barwę czekoladową,
b1 – allel recesywny zarówno w stosunku do B, jak i do b, warunkujący barwę cynamonową. Ekspresja genu odpowiedzialnego za produkcję eumelaniny modyfikowana jest przez autosomalny gen z innego chromosomu, którego allel D warunkuje równomierne rozproszenie barwnika, co daje normalną barwę włosa, natomiast recesywny allel d sprawia, że pigment występuje w skupiskach, co skutkuje rozjaśnieniem (rozmyciem) kolorów: czarnego – do niebieskiego, czekoladowego – do liliowego, a cynamonowego – do płowego.
Na podstawie: http://www.agiliscattus.pl/podstawy-genetyki-kotow.html
I.  Zapisz, stosując podane oznaczenia alleli genów odpowiedzialnych za kolor sierści, wszystkie możliwe genotypy niebieskiego kota brytyjskiego.
II. Zapisz, stosując podane oznaczenia alleli genów, genotypy kotów brytyjskich: cynamonowej samicy i czarnego samca, w których potomstwie znajdują się kocięta czarne, czekoladowe, niebieskie oraz liliowe.
III. Zapisz krzyżówkę genetyczną (szachownicę Punnetta) cynamonowej samicy i czarnego samca (rodziców z zadania poprzedniego) i na podstawie tej krzyżówki określ prawdopodobieństwo, że kolejne kocię tych rodziców będzie niebieskie.

Zadanie 169. (NR18)
W pewnej populacji motyli (populacja I), w której występują dwa allele warunkujące ubarwienie ciała, pozostającej w stanie równowagi genetycznej pod względem tych alleli, występowały zarówno motyle ciemne, jak i jasne. Jednorazowe pojawienie się drapieżnika spowodowało śmierć wszystkich osobników o fenotypie jasnym. W wyniku rozmnażania się osobników ciemnych, które przeżyły, powstała populacja II. Ubarwienie ciała tego gatunku motyla jest cechą autosomalną, determinowaną przez: dominujący allel A – warunkujący ubarwienie ciemne i recesywny allel a – warunkujący ubarwienie jasne.


I. Oblicz częstość allelu warunkującego ciemne ubarwienie ciała motyli w populacji I przed atakiem drapieżnika. Zapisz obliczenia.
II. Po przyjęciu założenia, że krzyżowanie się osobników jest losowe, określ, czy w populacji II motyli będą występowały osobniki o jasnym ubarwieniu ciała. Odpowiedź uzasadnij.